Transcript: Human XR_002957353.1

PREDICTED: Homo sapiens integrin alpha FG-GAP repeat containing 2 (ITFG2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITFG2 (55846)
Length:
3591
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957353.1
NBCI Gene record:
ITFG2 (55846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155875 CCAGGTTGTGCGTATGCAATT pLKO.1 705 3UTR 100% 10.800 15.120 N ITFG2 n/a
2 TRCN0000151385 GACGTTGATAACGATACGTTA pLKO.1 177 3UTR 100% 4.950 6.930 N ITFG2 n/a
3 TRCN0000156006 CCTGCCTCGTATATGTCACTT pLKO.1 1198 3UTR 100% 4.950 3.960 N ITFG2 n/a
4 TRCN0000440249 GCATGAGGAGGTAGTTGCATG pLKO_005 1055 3UTR 100% 4.050 3.240 N ITFG2 n/a
5 TRCN0000431483 ATGTCTCCACTCACCTAATTG pLKO_005 856 3UTR 100% 13.200 9.240 N ITFG2 n/a
6 TRCN0000431854 TCCGCTTCCAAGTGGATGAAA pLKO_005 1123 3UTR 100% 5.625 3.938 N ITFG2 n/a
7 TRCN0000438038 AGGTGAGGGTCCTGAACATCT pLKO_005 578 3UTR 100% 4.950 3.465 N ITFG2 n/a
8 TRCN0000437145 AGTAGTGGCTCTGGCCTCTTT pLKO_005 906 3UTR 100% 4.950 3.465 N ITFG2 n/a
9 TRCN0000152018 CGTATGCAATTCTACTGTGTA pLKO.1 715 3UTR 100% 4.950 3.465 N ITFG2 n/a
10 TRCN0000153467 GAGTCTACCAATCTGGTGAAA pLKO.1 1266 3UTR 100% 4.950 3.465 N ITFG2 n/a
11 TRCN0000438371 GACATCTGGCCGTATCCACAA pLKO_005 830 3UTR 100% 4.050 2.835 N ITFG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03665 pDONR223 100% 37.3% None 1_98del;1440_3591del n/a
2 ccsbBroad304_03665 pLX_304 0% 37.3% V5 1_98del;1440_3591del n/a
3 TRCN0000472774 GATTACGCAACGGCCTTGCCCTGT pLX_317 38.4% 37.3% V5 1_98del;1440_3591del n/a
Download CSV