Transcript: Human XR_002957534.1

PREDICTED: Homo sapiens solute carrier family 38 member 6 (SLC38A6), transcript variant X18, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC38A6 (145389)
Length:
1835
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957534.1
NBCI Gene record:
SLC38A6 (145389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044803 GCATACTATTTGCTGTGCTTT pLKO.1 1267 3UTR 100% 4.950 6.930 N SLC38A6 n/a
2 TRCN0000044807 CCATTCTCATGGATTCGCCAT pLKO.1 1353 3UTR 100% 2.160 3.024 N SLC38A6 n/a
3 TRCN0000044804 CCGTTGCTAAGCAACGAACTT pLKO.1 207 3UTR 100% 0.495 0.693 N SLC38A6 n/a
4 TRCN0000322860 ATGGACAAACACTACTAATAA pLKO_005 613 3UTR 100% 15.000 10.500 N SLC38A6 n/a
5 TRCN0000322929 ACCTCAATATTGCCCATATAC pLKO_005 906 3UTR 100% 13.200 9.240 N SLC38A6 n/a
6 TRCN0000322859 GATCACTCTAGCACTCAATAT pLKO_005 1379 3UTR 100% 13.200 9.240 N SLC38A6 n/a
7 TRCN0000044805 GCTACACAAGTAGTTTATCAT pLKO.1 691 3UTR 100% 5.625 3.938 N SLC38A6 n/a
8 TRCN0000300978 GCTACACAAGTAGTTTATCAT pLKO_005 691 3UTR 100% 5.625 3.938 N SLC38A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09618 pDONR223 100% 74.4% None (many diffs) n/a
2 ccsbBroad304_09618 pLX_304 0% 74.4% V5 (many diffs) n/a
3 TRCN0000477045 CCACTATGAATACCCCTTGTGGTA pLX_317 28.6% 74.4% V5 (many diffs) n/a
Download CSV