Transcript: Human XR_002957560.1

PREDICTED: Homo sapiens protein phosphatase 4 regulatory subunit 3A (PPP4R3A), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP4R3A (55671)
Length:
4568
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957560.1
NBCI Gene record:
PPP4R3A (55671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250195 ATGGGCCTGCTTCGAACTTTA pLKO_005 1993 3UTR 100% 13.200 18.480 N Ppp4r3a n/a
2 TRCN0000160818 CAGGCTTAGAATTGCCATCTT pLKO.1 1031 3UTR 100% 4.950 6.930 N PPP4R3A n/a
3 TRCN0000159785 GAAGTTATGTTCTCTGAAGAA pLKO.1 1273 3UTR 100% 4.950 6.930 N PPP4R3A n/a
4 TRCN0000165427 GCCCAACTATTGGCACTTGTA pLKO.1 2164 3UTR 100% 4.950 6.930 N PPP4R3A n/a
5 TRCN0000165183 GCTAGTTCTTATGGCCTCGAA pLKO.1 2268 3UTR 100% 2.640 3.696 N PPP4R3A n/a
6 TRCN0000166780 CTTCACCTCTTCGTCGTGAAA pLKO.1 1103 3UTR 100% 0.495 0.693 N PPP4R3A n/a
7 TRCN0000158507 CGTCATTGGATGTTTAGAATA pLKO.1 1305 3UTR 100% 13.200 10.560 N PPP4R3A n/a
8 TRCN0000250194 TGGTCATTTGTGTCATAATTT pLKO_005 4040 3UTR 100% 15.000 10.500 N Ppp4r3a n/a
9 TRCN0000160447 CAGATTTGTTTGCACAACTAA pLKO.1 1583 3UTR 100% 5.625 3.938 N PPP4R3A n/a
10 TRCN0000159371 GCACTTGTATTGGAATTGTTA pLKO.1 2176 3UTR 100% 5.625 3.938 N PPP4R3A n/a
11 TRCN0000178838 CTGACAGATTTGTTTGCACAA pLKO.1 1579 3UTR 100% 4.050 2.835 N Ppp4r3a n/a
12 TRCN0000159820 GCATGCTTTCTTGGCATTATA pLKO.1 2289 3UTR 100% 15.000 10.500 N PPP4R3A n/a
13 TRCN0000159890 GCACAACAGAATGATGATGAT pLKO.1 1858 3UTR 100% 4.950 3.960 N PPP4R3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12246 pDONR223 100% 39% None (many diffs) n/a
2 TRCN0000481139 GGTCTAAAGTTATAACAAACTGGT pLX_317 20.8% 39% V5 (many diffs) n/a
3 ccsbBroadEn_14203 pDONR223 94.5% 4% None 1_3335del;3519_4568del n/a
4 ccsbBroad304_14203 pLX_304 0% 4% V5 (not translated due to prior stop codon) 1_3335del;3519_4568del n/a
Download CSV