Transcript: Human XR_002957649.1

PREDICTED: Homo sapiens protein tyrosine phosphatase 4A2 (PTP4A2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTP4A2 (8073)
Length:
2951
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957649.1
NBCI Gene record:
PTP4A2 (8073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957649.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272605 ACGTTCTAGATTGGCCATTTG pLKO_005 284 3UTR 100% 10.800 15.120 N PTP4A2 n/a
2 TRCN0000380102 GACGACTTTGGTTCGAGTTTG pLKO_005 219 3UTR 100% 10.800 15.120 N PTP4A2 n/a
3 TRCN0000028999 CCTAATCAGATAGTAGATGAT pLKO.1 322 3UTR 100% 4.950 6.930 N Ptp4a2 n/a
4 TRCN0000002926 ATACCGACCTAAGATGCGATT pLKO.1 546 3UTR 100% 4.050 3.240 N PTP4A2 n/a
5 TRCN0000272545 ATACCGACCTAAGATGCGATT pLKO_005 546 3UTR 100% 4.050 3.240 N PTP4A2 n/a
6 TRCN0000350266 TTTCTGCCAGGATTGAATTAT pLKO_005 867 3UTR 100% 15.000 10.500 N PTP4A2 n/a
7 TRCN0000002927 CAGATAGTAGATGATTGGTTA pLKO.1 328 3UTR 100% 4.950 3.465 N PTP4A2 n/a
8 TRCN0000272546 CAGATAGTAGATGATTGGTTA pLKO_005 328 3UTR 100% 4.950 3.465 N PTP4A2 n/a
9 TRCN0000002925 CCTGTAGAATTGTGGGCTGTA pLKO.1 1550 3UTR 100% 4.050 2.835 N PTP4A2 n/a
10 TRCN0000010748 TGGTTCGAGTTTGTGATGCTA pLKO.1 227 3UTR 100% 3.000 2.100 N PTP4A2 n/a
11 TRCN0000029003 CAGTGCATTGTGTTGCAGGAT pLKO.1 395 3UTR 100% 2.640 1.848 N Ptp4a2 n/a
12 TRCN0000002924 CTTCAGAGATACCAATGGGCA pLKO.1 570 3UTR 100% 0.660 0.462 N PTP4A2 n/a
13 TRCN0000272607 CTTCAGAGATACCAATGGGCA pLKO_005 570 3UTR 100% 0.660 0.462 N PTP4A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957649.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01859 pDONR223 100% 16.9% None 1_102del;604_2951del n/a
2 ccsbBroad304_01859 pLX_304 0% 16.9% V5 1_102del;604_2951del n/a
3 TRCN0000474197 TGACCAAGTCCCTTATTCCACGCC pLX_317 88.8% 16.9% V5 1_102del;604_2951del n/a
Download CSV