Transcript: Human XR_002957657.1

PREDICTED: Homo sapiens DnaJ heat shock protein family (Hsp40) member C17 (DNAJC17), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAJC17 (55192)
Length:
1501
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957657.1
NBCI Gene record:
DNAJC17 (55192)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232871 GGTGGAGTTTGCAACCGTCAA pLKO_005 748 3UTR 100% 4.050 3.240 N DNAJC17 n/a
2 TRCN0000232872 AGCCACTCAGGACTGTCAAAG pLKO_005 866 3UTR 100% 10.800 7.560 N DNAJC17 n/a
3 TRCN0000232868 GCAGCGGACAAAGAGGTAAAG pLKO_005 95 3UTR 100% 10.800 7.560 N DNAJC17 n/a
4 TRCN0000074663 CCTGGTGCTTTCCAGTAAGAA pLKO.1 712 3UTR 100% 5.625 3.938 N DNAJC17 n/a
5 TRCN0000232870 CCTGGTGCTTTCCAGTAAGAA pLKO_005 712 3UTR 100% 5.625 3.938 N DNAJC17 n/a
6 TRCN0000074665 CCTGGTGGATAACCCTCTGAA pLKO.1 802 3UTR 100% 4.950 3.465 N DNAJC17 n/a
7 TRCN0000074666 GCAGCCACTCAGGACTGTCAA pLKO.1 864 3UTR 100% 1.650 1.155 N DNAJC17 n/a
8 TRCN0000074664 GCATATGACAAGGTCAGGAAA pLKO.1 242 3UTR 100% 0.000 0.000 N DNAJC17 n/a
9 TRCN0000074667 CAGGACACTAGAGCAAGAGAT pLKO.1 394 3UTR 100% 4.950 2.970 N DNAJC17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03546 pDONR223 100% 60.7% None 1_31del;630_692del;1007_1501del n/a
2 ccsbBroad304_03546 pLX_304 73.4% 60.7% V5 1_31del;630_692del;1007_1501del n/a
3 TRCN0000465462 TTCACAATTCCGATAGGGCGTGTC pLX_317 36.4% 60.7% V5 1_31del;630_692del;1007_1501del n/a
Download CSV