Transcript: Human XR_002957834.1

PREDICTED: Homo sapiens unk like zinc finger (UNKL), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UNKL (64718)
Length:
3849
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957834.1
NBCI Gene record:
UNKL (64718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033914 CTCTTCGAGTGCAAGTCCAAA pLKO.1 2051 3UTR 100% 4.950 6.930 N UNKL n/a
2 TRCN0000137761 GTACTGCTCCAAGTACAACGA pLKO.1 295 3UTR 100% 0.264 0.185 N UNKL n/a
3 TRCN0000033915 CCCGGGAGCATCTGGGACTTT pLKO.1 1974 3UTR 100% 0.000 0.000 N UNKL n/a
4 TRCN0000033918 CCTGCCGAAGCTGCACTCGCT pLKO.1 2360 3UTR 100% 0.000 0.000 N UNKL n/a
5 TRCN0000033917 CCTGTCAGCACCACATCCTCT pLKO.1 2491 3UTR 100% 0.880 0.528 N UNKL n/a
6 TRCN0000137735 GATTGAGAAGATCCTGAGCGA pLKO.1 619 3UTR 100% 0.660 0.396 N UNKL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08860 pDONR223 100% 20.6% None (many diffs) n/a
2 ccsbBroad304_08860 pLX_304 0% 20.6% V5 (many diffs) n/a
3 TRCN0000478815 CGAGCGTTTAGGCCCATGTGTTTC pLX_317 38.6% 20.6% V5 (many diffs) n/a
Download CSV