Transcript: Human XR_002958592.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 25 (USP25), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP25 (29761)
Length:
5313
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958592.1
NBCI Gene record:
USP25 (29761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004369 GCGTGAGCTGAGGTATCTATT pLKO.1 1113 3UTR 100% 13.200 18.480 N USP25 n/a
2 TRCN0000318645 GCGTGAGCTGAGGTATCTATT pLKO_005 1113 3UTR 100% 13.200 18.480 N USP25 n/a
3 TRCN0000004366 GCACTTCTCCTGTTGACGATA pLKO.1 1841 3UTR 100% 4.950 6.930 N USP25 n/a
4 TRCN0000318646 GCACTTCTCCTGTTGACGATA pLKO_005 1841 3UTR 100% 4.950 6.930 N USP25 n/a
5 TRCN0000004370 TGGAGGAGTAAGATGAAATAT pLKO.1 5033 3UTR 100% 15.000 10.500 N USP25 n/a
6 TRCN0000004367 GCTGTAGAAGATATGAGAAAT pLKO.1 3499 3UTR 100% 13.200 9.240 N USP25 n/a
7 TRCN0000318647 GCTGTAGAAGATATGAGAAAT pLKO_005 3499 3UTR 100% 13.200 9.240 N USP25 n/a
8 TRCN0000004368 GCTGTTCCTCATCTGTGCTTA pLKO.1 3249 3UTR 100% 4.950 3.465 N USP25 n/a
9 TRCN0000349572 GCTGTTCCTCATCTGTGCTTA pLKO_005 3249 3UTR 100% 4.950 3.465 N USP25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03088 pDONR223 100% 59.5% None 1_447del;3043_3153del;3724_5313del n/a
2 ccsbBroad304_03088 pLX_304 0% 59.5% V5 1_447del;3043_3153del;3724_5313del n/a
3 TRCN0000467162 GTTAGACCGGTCGCTGGTCCGGGT pLX_317 14.4% 59.5% V5 1_447del;3043_3153del;3724_5313del n/a
4 ccsbBroadEn_11902 pDONR223 100% 25.4% None 1_447del;1228_3153del;3724_5313del n/a
5 ccsbBroad304_11902 pLX_304 0% 25.4% V5 1_447del;1228_3153del;3724_5313del n/a
Download CSV