Transcript: Human XR_002959348.1

PREDICTED: Homo sapiens transmembrane protein 177 (TMEM177), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM177 (80775)
Length:
2803
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959348.1
NBCI Gene record:
TMEM177 (80775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143556 GCTATGAATCTGAGCCTTTGT pLKO.1 1560 3UTR 100% 4.950 6.930 N TMEM177 n/a
2 TRCN0000275641 GCTATGAATCTGAGCCTTTGT pLKO_005 1560 3UTR 100% 4.950 6.930 N TMEM177 n/a
3 TRCN0000275642 TCCAATGGCTCTACCAGTACT pLKO_005 561 3UTR 100% 4.950 6.930 N TMEM177 n/a
4 TRCN0000121706 CAGACACTTGTTCCGAATCAA pLKO.1 1276 3UTR 100% 5.625 4.500 N TMEM177 n/a
5 TRCN0000275709 CTAACCATCCCGTGGTCATAC pLKO_005 789 3UTR 100% 10.800 7.560 N TMEM177 n/a
6 TRCN0000275708 GTGGTGGAGTGGAGTTCTATG pLKO_005 1167 3UTR 100% 10.800 7.560 N TMEM177 n/a
7 TRCN0000140507 GTTGGAGCCTTTGGACCTATA pLKO.1 1440 3UTR 100% 10.800 7.560 N TMEM177 n/a
8 TRCN0000275711 GTTGGAGCCTTTGGACCTATA pLKO_005 1440 3UTR 100% 10.800 7.560 N TMEM177 n/a
9 TRCN0000144138 CTATGAATCTGAGCCTTTGTT pLKO.1 1561 3UTR 100% 5.625 3.938 N TMEM177 n/a
10 TRCN0000139417 CCAGACACTTGTTCCGAATCA pLKO.1 1275 3UTR 100% 4.950 3.465 N TMEM177 n/a
11 TRCN0000200056 CCTCTTCCAAGAGGTGCTAAA pLKO.1 625 3UTR 100% 1.080 0.756 N Tmem177 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1806 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1806 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09048 pDONR223 100% 33.1% None (many diffs) n/a
2 ccsbBroad304_09048 pLX_304 0% 33.1% V5 (many diffs) n/a
3 TRCN0000465490 GAGATCAGAGCTTCTTTAACGTAA pLX_317 31.3% 33.1% V5 (many diffs) n/a
4 TRCN0000489516 GCGGCCGACCCGTCATACTAATAA pLX_317 44.9% 33.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV