Transcript: Human XR_002959363.1

PREDICTED: Homo sapiens DExH-box helicase 57 (DHX57), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DHX57 (90957)
Length:
4125
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959363.1
NBCI Gene record:
DHX57 (90957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959363.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241887 ACTATACCAGGTCGTACATTT pLKO_005 2258 3UTR 100% 13.200 18.480 N DHX57 n/a
2 TRCN0000241884 GACCTAGCAACAGTAACATAA pLKO_005 327 3UTR 100% 13.200 18.480 N DHX57 n/a
3 TRCN0000073049 GCACCTGTTATAGTAGAGAAT pLKO.1 1562 3UTR 100% 4.950 3.960 N DHX57 n/a
4 TRCN0000241883 AGGCGTGCGTGCAAGTTATAA pLKO_005 3514 3UTR 100% 15.000 10.500 N DHX57 n/a
5 TRCN0000241886 ACGGAACTGTTATCGGATATA pLKO_005 3693 3UTR 100% 13.200 9.240 N DHX57 n/a
6 TRCN0000073050 CCTTGACATTTGCGGAAACTT pLKO.1 1293 3UTR 100% 5.625 3.938 N DHX57 n/a
7 TRCN0000073051 CCTTTGGAATATGCTGGCTTA pLKO.1 590 3UTR 100% 4.050 2.835 N DHX57 n/a
8 TRCN0000073052 GCATCACTAGAGCATCTCCTT pLKO.1 737 3UTR 100% 2.640 1.584 N DHX57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959363.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467843 CTAGGCATTTACTTGCGCACACGC pLX_317 9.3% 90.1% V5 (many diffs) n/a
2 ccsbBroadEn_12952 pDONR223 100% 39.7% None (many diffs) n/a
3 ccsbBroad304_12952 pLX_304 0% 39.7% V5 (many diffs) n/a
4 TRCN0000473725 ATTGTGCATTCTAAGTTCATACGT pLX_317 25.1% 39.7% V5 (many diffs) n/a
Download CSV