Transcript: Human XR_002959527.1

PREDICTED: Homo sapiens microtubule associated protein 4 (MAP4), transcript variant X17, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP4 (4134)
Length:
11235
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959527.1
NBCI Gene record:
MAP4 (4134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117165 CCACCATTGGTGGGTTGAATA pLKO.1 5736 3UTR 100% 13.200 18.480 N MAP4 n/a
2 TRCN0000117163 CGTGATCTTGACCAAGGATAA pLKO.1 1480 3UTR 100% 10.800 8.640 N MAP4 n/a
3 TRCN0000301056 CGTGATCTTGACCAAGGATAA pLKO_005 1480 3UTR 100% 10.800 8.640 N MAP4 n/a
4 TRCN0000117162 CCAGATTCTATCCTCATCTTT pLKO.1 9365 3UTR 100% 5.625 4.500 N MAP4 n/a
5 TRCN0000117166 CCTACCAGGAATACCCAAATA pLKO.1 435 3UTR 100% 13.200 9.240 N MAP4 n/a
6 TRCN0000301054 CCTACCAGGAATACCCAAATA pLKO_005 435 3UTR 100% 13.200 9.240 N MAP4 n/a
7 TRCN0000323350 CTATCCAGACTGATCCCTTTA pLKO_005 513 3UTR 100% 10.800 7.560 N MAP4 n/a
8 TRCN0000323351 TAGGAGAGGAGAACCAGATTC pLKO_005 9352 3UTR 100% 10.800 7.560 N MAP4 n/a
9 TRCN0000117164 CCCTGGTTAAGGATGTCAGAT pLKO.1 1053 3UTR 100% 4.950 3.465 N MAP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10958 pDONR223 100% 25.8% None (many diffs) n/a
2 ccsbBroad304_10958 pLX_304 0% 25.8% V5 (many diffs) n/a
3 TRCN0000478522 TCGACCACTTATCGGTCATGTGCA pLX_317 10.8% 25.8% V5 (many diffs) n/a
Download CSV