Transcript: Human XR_002959705.1

PREDICTED: Homo sapiens kelch like family member 2 (KLHL2), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHL2 (11275)
Length:
2986
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959705.1
NBCI Gene record:
KLHL2 (11275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064965 CGAACAAGTGTGCAGCTTAAT pLKO.1 762 3UTR 100% 13.200 18.480 N KLHL2 n/a
2 TRCN0000300128 CGAACAAGTGTGCAGCTTAAT pLKO_005 762 3UTR 100% 13.200 18.480 N KLHL2 n/a
3 TRCN0000064963 CCGAGCAAAGAGAGTTAGAAT pLKO.1 441 3UTR 100% 5.625 7.875 N KLHL2 n/a
4 TRCN0000300129 CCGAGCAAAGAGAGTTAGAAT pLKO_005 441 3UTR 100% 5.625 7.875 N KLHL2 n/a
5 TRCN0000064966 CGTCAGTGTCTTAGCACAGTA pLKO.1 1425 3UTR 100% 4.950 3.960 N KLHL2 n/a
6 TRCN0000300189 CGTCAGTGTCTTAGCACAGTA pLKO_005 1425 3UTR 100% 4.950 3.960 N KLHL2 n/a
7 TRCN0000064964 GCTTGCAAAGATTACCTCATT pLKO.1 973 3UTR 100% 4.950 3.960 N KLHL2 n/a
8 TRCN0000300187 GCTTGCAAAGATTACCTCATT pLKO_005 973 3UTR 100% 4.950 3.960 N KLHL2 n/a
9 TRCN0000064967 GCAGAAATTCAGGTTACAGAA pLKO.1 514 3UTR 100% 4.950 3.465 N KLHL2 n/a
10 TRCN0000331228 GCAGAAATTCAGGTTACAGAA pLKO_005 514 3UTR 100% 4.950 3.465 N KLHL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07792 pDONR223 100% 53.1% None (many diffs) n/a
2 ccsbBroad304_07792 pLX_304 0% 53.1% V5 (many diffs) n/a
3 TRCN0000467596 TTCATGAAGCTCCGCGGTCAGTTA pLX_317 25.2% 53.1% V5 (many diffs) n/a
Download CSV