Transcript: Human XR_002959732.1

PREDICTED: Homo sapiens ADP-ribosyltransferase 3 (ART3), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ART3 (419)
Length:
2795
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959732.1
NBCI Gene record:
ART3 (419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036447 CCTGAAATGTACGGACAGGAT pLKO.1 239 3UTR 100% 2.640 3.696 N ART3 n/a
2 TRCN0000036448 GCCCGAAAGACTCAAATCTTT pLKO.1 354 3UTR 100% 0.563 0.788 N ART3 n/a
3 TRCN0000422117 ATCAGTGTTTCTGCTATAAAT pLKO_005 2488 3UTR 100% 15.000 10.500 N ART3 n/a
4 TRCN0000435200 GTATTGAGAACCTAGAATATT pLKO_005 919 3UTR 100% 15.000 10.500 N ART3 n/a
5 TRCN0000434866 GAATAGCCCTGATGGCATATA pLKO_005 403 3UTR 100% 13.200 9.240 N ART3 n/a
6 TRCN0000036446 CCAGGGCACTTCATTTACATT pLKO.1 614 3UTR 100% 5.625 3.938 N ART3 n/a
7 TRCN0000036445 GCTGGCAATAACCTTATCCTT pLKO.1 831 3UTR 100% 3.000 2.100 N ART3 n/a
8 TRCN0000036444 CCATGATTCTAGTGGACATTT pLKO.1 163 3UTR 100% 13.200 7.920 N ART3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00108 pDONR223 100% 38.9% None (many diffs) n/a
2 ccsbBroad304_00108 pLX_304 0% 38.9% V5 (many diffs) n/a
3 TRCN0000465777 CTAAGCTAAGTTTCGTGCCGGAGG pLX_317 30.7% 38.9% V5 (many diffs) n/a
4 ccsbBroadEn_05854 pDONR223 100% 38.4% None (many diffs) n/a
5 ccsbBroad304_05854 pLX_304 0% 38.4% V5 (many diffs) n/a
6 TRCN0000466162 GAGGAATCTTCGTGCCCGAAATAT pLX_317 8.3% 38.4% V5 (many diffs) n/a
7 TRCN0000489315 CCTGTATGGTATTGTCGGAGACCT pLX_317 31% 38.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV