Transcript: Mouse XR_003946532.1

PREDICTED: Mus musculus synaptotagmin IX (Syt9), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Syt9 (60510)
Length:
3548
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003946532.1
NBCI Gene record:
Syt9 (60510)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003946532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380791 ACCTGTCGAACCCGGACTTTA pLKO_005 473 3UTR 100% 13.200 18.480 N Syt9 n/a
2 TRCN0000379942 GCACGACAGCTGCCAAGATTT pLKO_005 379 3UTR 100% 13.200 18.480 N Syt9 n/a
3 TRCN0000379944 GCGGGAAACTGAACTTCATTT pLKO_005 611 3UTR 100% 13.200 18.480 N Syt9 n/a
4 TRCN0000379591 AGATCCACAAAGCCGTCAATC pLKO_005 668 3UTR 100% 10.800 15.120 N Syt9 n/a
5 TRCN0000119977 GCCTAGAAGAATGGTCCCAAA pLKO.1 3137 3UTR 100% 4.050 5.670 N Syt9 n/a
6 TRCN0000380247 ACCAAGAGGAACACGCTTAAT pLKO_005 1177 3UTR 100% 13.200 9.240 N Syt9 n/a
7 TRCN0000382363 GAGTATGTCACCAACGATAAT pLKO_005 979 3UTR 100% 13.200 9.240 N Syt9 n/a
8 TRCN0000027686 GCTGACCATCACCATCATAAA pLKO.1 1053 3UTR 100% 13.200 9.240 N LOC381993 n/a
9 TRCN0000381692 GATGGAGAAACGATGACTATG pLKO_005 1405 3UTR 100% 10.800 7.560 N Syt9 n/a
10 TRCN0000381608 GCGACTTGGAACAGCTCATTG pLKO_005 644 3UTR 100% 10.800 7.560 N Syt9 n/a
11 TRCN0000380632 TCGGACAACCATGTAACAAAG pLKO_005 1457 3UTR 100% 10.800 7.560 N Syt9 n/a
12 TRCN0000119980 GCTGACTGGGATTGGTAGAAT pLKO.1 522 3UTR 100% 5.625 3.938 N Syt9 n/a
13 TRCN0000027683 CCCGTTTACAATGAAGCCATA pLKO.1 1198 3UTR 100% 4.050 2.835 N LOC381993 n/a
14 TRCN0000027751 CGATGGACATAACAGGAGCAT pLKO.1 1091 3UTR 100% 2.640 1.848 N LOC381993 n/a
15 TRCN0000119981 GCTCATTGTGAAGATCCACAA pLKO.1 657 3UTR 100% 0.405 0.284 N Syt9 n/a
16 TRCN0000027678 CGGAGACTGAAGAAGAGGAAA pLKO.1 1150 3UTR 100% 4.950 2.970 N LOC381993 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003946532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04964 pDONR223 100% 26.1% None (many diffs) n/a
2 ccsbBroad304_04964 pLX_304 0% 26.1% V5 (many diffs) n/a
3 TRCN0000491923 TTACTCCAGGGGGTACAGAGTTTT pLX_317 26.7% 26.1% V5 (many diffs) n/a
Download CSV