Transcript: Mouse XR_003947970.1

PREDICTED: Mus musculus COMM domain containing 4 (Commd4), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Commd4 (66199)
Length:
912
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003947970.1
NBCI Gene record:
Commd4 (66199)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003947970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375726 GTGCCGCTGTTACGAAGAGAA pLKO_005 425 3UTR 100% 4.950 6.930 N Commd4 n/a
2 TRCN0000375728 CATCTGCAGCTACAGGTTGTG pLKO_005 573 3UTR 100% 4.050 5.670 N Commd4 n/a
3 TRCN0000184616 GTTTGAGTCTGGAGACGTGAA pLKO.1 252 3UTR 100% 4.050 5.670 N Commd4 n/a
4 TRCN0000340173 GTTTGAGTCTGGAGACGTGAA pLKO_005 252 3UTR 100% 4.050 5.670 N Commd4 n/a
5 TRCN0000340175 CTGTGTAGCCAGGTGCTAAAG pLKO_005 172 3UTR 100% 10.800 7.560 N Commd4 n/a
6 TRCN0000375727 CAGACCATGATGACTGCTTTG pLKO_005 681 3UTR 100% 6.000 4.200 N Commd4 n/a
7 TRCN0000184674 CTGCTGATGCCAAGTTTGAGT pLKO.1 239 3UTR 100% 3.000 2.100 N Commd4 n/a
8 TRCN0000184568 GAAGCTTACTGCTGATGCCAA pLKO.1 231 3UTR 100% 2.640 1.848 N Commd4 n/a
9 TRCN0000196014 GACAGTGATTCCTTGTCCAGT pLKO.1 328 3UTR 100% 2.640 1.848 N Commd4 n/a
10 TRCN0000340174 GACAGTGATTCCTTGTCCAGT pLKO_005 328 3UTR 100% 2.640 1.848 N Commd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003947970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03489 pDONR223 100% 57% None (many diffs) n/a
2 ccsbBroad304_03489 pLX_304 0% 57% V5 (many diffs) n/a
3 TRCN0000479852 TGGTAACCCCCCAGACACTCCAAT pLX_317 62% 57% V5 (many diffs) n/a
Download CSV