Transcript: Mouse XR_141051.5

PREDICTED: Mus musculus predicted gene 12174 (Gm12174), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm12174 (620678)
Length:
906
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_141051.5
NBCI Gene record:
Gm12174 (620678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_141051.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271705 GGATTGCCTTGACAGATAATT pLKO_005 583 3UTR 100% 15.000 7.500 Y Rpl7 n/a
2 TRCN0000284497 CATCTGCATGGAGGATCTAAT pLKO_005 638 3UTR 100% 13.200 6.600 Y Rpl7 n/a
3 TRCN0000271761 TCCTGTGGCCCTTCAAGTTAT pLKO_005 706 3UTR 100% 13.200 6.600 Y Rpl7 n/a
4 TRCN0000271707 ACTGTGCCAGGAACCCTTAAG pLKO_005 57 3UTR 100% 10.800 5.400 Y Rpl7 n/a
5 TRCN0000271706 CAAGGAGGAAGCTCATCTATG pLKO_005 220 3UTR 100% 10.800 5.400 Y Rpl7 n/a
6 TRCN0000096865 GCTCGGTCTCTTGGTAAGTTT pLKO.1 612 3UTR 100% 5.625 2.813 Y Rpl7 n/a
7 TRCN0000096868 GCACCTTTGTTAAGCTCAACA pLKO.1 445 3UTR 100% 4.950 2.475 Y Rpl7 n/a
8 TRCN0000096866 GCTGGCCTTTGTCATCAGAAT pLKO.1 350 3UTR 100% 4.950 2.475 Y Rpl7 n/a
9 TRCN0000096864 GCGAAGGAATTTCGCAGAGTT pLKO.1 149 3UTR 100% 0.495 0.248 Y Rpl7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_141051.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01418 pDONR223 100% 72.7% None (many diffs) n/a
2 ccsbBroad304_01418 pLX_304 0% 72.7% V5 (many diffs) n/a
3 TRCN0000481412 ACTTATTTCTAGCCTTCCGGCGTG pLX_317 51.5% 72.7% V5 (many diffs) n/a
Download CSV