Transcript: Human XR_243507.2

PREDICTED: Homo sapiens zinc finger protein 276 (ZNF276), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF276 (92822)
Length:
2248
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_243507.2
NBCI Gene record:
ZNF276 (92822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_243507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017765 CCACCATCTACAAGTGTCCTT pLKO.1 1370 3UTR 100% 2.640 2.112 N ZNF276 n/a
2 TRCN0000244277 ACACAGAGGTGCGGAACTATA pLKO_005 1547 3UTR 100% 13.200 9.240 N ZNF276 n/a
3 TRCN0000244380 CTCTGGTAAGAAGAGTGAAAG pLKO_005 1251 3UTR 100% 10.800 7.560 N ZNF276 n/a
4 TRCN0000244378 TCAAGTGGCCATGGGACAAAG pLKO_005 854 3UTR 100% 10.800 7.560 N ZNF276 n/a
5 TRCN0000280643 CCACGACTACACCATGGATAC pLKO_005 789 3UTR 100% 6.000 4.200 N ZNF276 n/a
6 TRCN0000017764 CCATCTTCAACCTCGGATGAT pLKO.1 1108 3UTR 100% 4.950 3.465 N ZNF276 n/a
7 TRCN0000017767 CCTTTGAGCCTTACCCAGAAA pLKO.1 1223 3UTR 100% 4.950 3.465 N ZNF276 n/a
8 TRCN0000017763 CGGCATGAAGAAGCACATCAA pLKO.1 1425 3UTR 100% 4.950 3.465 N ZNF276 n/a
9 TRCN0000017766 CCAAGAAGTCTGAAGAACCAA pLKO.1 1280 3UTR 100% 3.000 2.100 N ZNF276 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_243507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09351 pDONR223 100% 70.4% None (many diffs) n/a
2 ccsbBroad304_09351 pLX_304 0% 70.4% V5 (many diffs) n/a
3 TRCN0000470299 CTAGGAGCTGCGTTGACTGCGTTT pLX_317 23.8% 70.4% V5 (many diffs) n/a
4 ccsbBroadEn_12982 pDONR223 100% 49.7% None 1_801del;865T>C;1921_2248del n/a
5 ccsbBroad304_12982 pLX_304 0% 49.7% V5 1_801del;865T>C;1921_2248del n/a
6 TRCN0000491426 GCCGACGTGCCGGACTAACATATT pLX_317 28.2% 49.7% V5 1_801del;865T>C;1921_2248del n/a
Download CSV