Transcript: Human XR_244368.4

PREDICTED: Homo sapiens structural maintenance of chromosomes 1B (SMC1B), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMC1B (27127)
Length:
4233
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_244368.4
NBCI Gene record:
SMC1B (27127)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_244368.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151815 CCAGGAAGATATCTTACTGAA pLKO.1 3128 3UTR 100% 4.950 6.930 N SMC1B n/a
2 TRCN0000152156 CCAGTTTCAGATGATAGTCAT pLKO.1 3562 3UTR 100% 4.950 6.930 N SMC1B n/a
3 TRCN0000359556 AGTCAGCTGGATCGTTATAAA pLKO_005 1212 3UTR 100% 15.000 10.500 N SMC1B n/a
4 TRCN0000156217 CGAAGAGGATGCACAGTTTAA pLKO.1 638 3UTR 100% 13.200 9.240 N SMC1B n/a
5 TRCN0000359553 GGGAACTGTAGAGTCAATTTC pLKO_005 515 3UTR 100% 13.200 9.240 N SMC1B n/a
6 TRCN0000155713 CAGTGAATGAACTCATGGCAA pLKO.1 2689 3UTR 100% 2.640 1.848 N SMC1B n/a
7 TRCN0000155357 CATGGAGAAGTTCAGGGAAAT pLKO.1 1344 3UTR 100% 10.800 6.480 N SMC1B n/a
8 TRCN0000159478 CACCTTAAGAAGAAACTGAAA pLKO.1 2583 3UTR 100% 4.950 2.475 Y CT45A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_244368.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11845 pDONR223 100% 82.2% None (many diffs) n/a
2 ccsbBroad304_11845 pLX_304 0% 82.2% V5 (many diffs) n/a
3 TRCN0000480860 GTTGGACTCTATGCTTACAGCAAG pLX_317 12% 82.2% V5 (many diffs) n/a
Download CSV