Transcript: Human XR_244925.2

PREDICTED: Homo sapiens galactose mutarotase (GALM), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALM (130589)
Length:
1158
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_244925.2
NBCI Gene record:
GALM (130589)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_244925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049486 TCACCATAGAAGCGGATACTT pLKO.1 821 3UTR 100% 5.625 7.875 N GALM n/a
2 TRCN0000049483 CCATACTTTGGAGCAGTTATT pLKO.1 448 3UTR 100% 13.200 9.240 N GALM n/a
3 TRCN0000049487 ACAATTTCTGTCTGAAGGGAT pLKO.1 1042 3UTR 100% 2.640 1.848 N GALM n/a
4 TRCN0000049484 CCTGTGGATGAAACCCTGATT pLKO.1 847 3UTR 100% 4.950 2.970 N GALM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_244925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04864 pDONR223 100% 63.3% None 1_240del;872_942del;1158_1159ins179 n/a
2 ccsbBroad304_04864 pLX_304 0% 63.3% V5 1_240del;872_942del;1158_1159ins179 n/a
3 TRCN0000470053 GGCACGATCACTATGGCCTGGCGC pLX_317 47.1% 63.3% V5 1_240del;872_942del;1158_1159ins179 n/a
Download CSV