Transcript: Mouse XR_373935.3

PREDICTED: Mus musculus signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 (Stam), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stam (20844)
Length:
1764
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_373935.3
NBCI Gene record:
Stam (20844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_373935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382506 GGATAATGAGCTTACCTTTAA pLKO_005 1318 3UTR 100% 13.200 18.480 N Stam n/a
2 TRCN0000175141 GAAGATTTAGCCAAAGCTATT pLKO.1 1163 3UTR 100% 10.800 15.120 N Stam n/a
3 TRCN0000340133 GAAGATTTAGCCAAAGCTATT pLKO_005 1163 3UTR 100% 10.800 15.120 N Stam n/a
4 TRCN0000380728 GCAATGATCAAGAACCTTAAG pLKO_005 1031 3UTR 100% 10.800 7.560 N Stam n/a
5 TRCN0000004063 TGTGTATCAAACTGTGGCAAA pLKO.1 857 3UTR 100% 4.050 2.835 N STAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_373935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11252 pDONR223 100% 50% None (many diffs) n/a
2 ccsbBroad304_11252 pLX_304 0% 50% V5 (many diffs) n/a
3 TRCN0000469240 GAGCGTTCGCCGCTAGAAAAAAAA pLX_317 30.1% 50% V5 (many diffs) n/a
Download CSV