Transcript: Mouse XR_374406.3

PREDICTED: Mus musculus FK506 binding protein 7 (Fkbp7), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fkbp7 (14231)
Length:
695
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374406.3
NBCI Gene record:
Fkbp7 (14231)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349890 GGTGTCGGACATGTCATAAAG pLKO_005 377 3UTR 100% 13.200 18.480 N Fkbp7 n/a
2 TRCN0000111821 GCAACTCTGATGTTTGAGATT pLKO.1 628 3UTR 100% 4.950 3.960 N Fkbp7 n/a
3 TRCN0000312377 GCAACTCTGATGTTTGAGATT pLKO_005 628 3UTR 100% 4.950 3.960 N Fkbp7 n/a
4 TRCN0000111823 CCAAGGAGCATTGAAACATTT pLKO.1 673 3UTR 100% 13.200 9.240 N Fkbp7 n/a
5 TRCN0000349955 AGACTTGCTAAATGCCCATTA pLKO_005 274 3UTR 100% 10.800 7.560 N Fkbp7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03359 pDONR223 100% 44% None (many diffs) n/a
2 ccsbBroad304_03359 pLX_304 0% 44% V5 (many diffs) n/a
3 TRCN0000474688 CACACAATAATACTTGCGAGTAAT pLX_317 25.5% 44% V5 (many diffs) n/a
Download CSV