Transcript: Mouse XR_374475.1

PREDICTED: Mus musculus kelch-like 23 (Klhl23), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klhl23 (277396)
Length:
3797
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374475.1
NBCI Gene record:
Klhl23 (277396)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215821 CCTATCGCAAACATGATTAAA pLKO.1 1489 3UTR 100% 15.000 21.000 N Klhl23 n/a
2 TRCN0000194234 GCTCCAGGTTTAAGGAAGTTT pLKO.1 785 3UTR 100% 5.625 7.875 N Klhl23 n/a
3 TRCN0000216571 GAGCAGAAATACCAGATTATA pLKO.1 1202 3UTR 100% 15.000 10.500 N Klhl23 n/a
4 TRCN0000415755 ATGCTCAATGCCAGGTATTAC pLKO_005 1360 3UTR 100% 13.200 9.240 N KLHL23 n/a
5 TRCN0000216980 CTACAACCTGCTAAGCTATAT pLKO.1 954 3UTR 100% 13.200 9.240 N Klhl23 n/a
6 TRCN0000006956 CCTTTGACAAATGTTTGGATT pLKO.1 1177 3UTR 100% 4.950 3.465 N KLHL23 n/a
7 TRCN0000174332 CAGAGTATCGAGAAATACGAT pLKO.1 1870 3UTR 100% 3.000 2.100 N Klhl23 n/a
8 TRCN0000193370 CCAGATCTTAATAAGTGGGAA pLKO.1 1891 3UTR 100% 2.640 1.848 N Klhl23 n/a
9 TRCN0000194233 GCTCAGAACTAGAGAAGGAAT pLKO.1 749 3UTR 100% 4.950 2.970 N Klhl23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09679 pDONR223 100% 39.7% None (many diffs) n/a
2 ccsbBroad304_09679 pLX_304 0% 39.7% V5 (many diffs) n/a
3 TRCN0000466460 CAATTACAGAATAACGTAGCTAAC pLX_317 20% 39.7% V5 (many diffs) n/a
Download CSV