Transcript: Mouse XR_375601.3

PREDICTED: Mus musculus CUGBP, Elav-like family member 3 (Celf3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Celf3 (78784)
Length:
4069
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_375601.3
NBCI Gene record:
Celf3 (78784)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_375601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098695 CCTGGCTTCAAGAGCCTATTT pLKO.1 3190 3UTR 100% 13.200 10.560 N Celf3 n/a
2 TRCN0000439110 ATGCAAACAGGCCCTACTAAG pLKO_005 2122 3UTR 100% 10.800 8.640 N Celf3 n/a
3 TRCN0000098697 GTTTGAACCATTTGGGACTAT pLKO.1 998 3UTR 100% 4.950 3.960 N Celf3 n/a
4 TRCN0000436726 AGCCCATCTTCGAGCAGTTTG pLKO_005 727 3UTR 100% 10.800 7.560 N Celf3 n/a
5 TRCN0000005729 GCGCCTCAAAGTCCAGCTAAA pLKO.1 2090 3UTR 100% 10.800 7.560 N CELF3 n/a
6 TRCN0000418643 GCGCCTCAAAGTCCAGCTAAA pLKO_005 2090 3UTR 100% 10.800 7.560 N Celf3 n/a
7 TRCN0000422671 GCTTTGTGAGTTTCGACAATC pLKO_005 2014 3UTR 100% 10.800 7.560 N CELF3 n/a
8 TRCN0000431535 GCTTTGTGAGTTTCGACAATC pLKO_005 2014 3UTR 100% 10.800 7.560 N Celf3 n/a
9 TRCN0000098699 CTTCGAGCTGACTGTCATCAA pLKO.1 755 3UTR 100% 4.950 3.465 N Celf3 n/a
10 TRCN0000098696 CCTCCAGATGTTTGTCCCTTT pLKO.1 1931 3UTR 100% 4.050 2.835 N Celf3 n/a
11 TRCN0000098698 CTATGCAGGAATGCAGCACTA pLKO.1 1703 3UTR 100% 4.050 2.835 N Celf3 n/a
12 TRCN0000005730 GCTGACTGTCATCAAGGACAA pLKO.1 761 3UTR 100% 4.050 2.835 N CELF3 n/a
13 TRCN0000422770 GAGAAGACCGGAAGCTCTTTG pLKO_005 931 3UTR 100% 10.800 6.480 N CELF3 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2379 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_375601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11611 pDONR223 100% 32.2% None (many diffs) n/a
2 ccsbBroad304_11611 pLX_304 0% 32.2% V5 (many diffs) n/a
3 TRCN0000475880 TCGTGGCATCAAGGAAGATTCACG pLX_317 23.5% 32.2% V5 (many diffs) n/a
Download CSV