Transcript: Mouse XR_378207.3

PREDICTED: Mus musculus arrestin, beta 1 (Arrb1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arrb1 (109689)
Length:
1862
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_378207.3
NBCI Gene record:
Arrb1 (109689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_378207.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075644 CCTTGAGGCATCACTGGATAA pLKO.1 871 3UTR 100% 10.800 15.120 N Arrb1 n/a
2 TRCN0000327471 CCTTGAGGCATCACTGGATAA pLKO_005 871 3UTR 100% 10.800 15.120 N Arrb1 n/a
3 TRCN0000075646 GACATTGTATTTGAGGACTTT pLKO.1 1782 3UTR 100% 4.950 3.465 N Arrb1 n/a
4 TRCN0000327472 GACATTGTATTTGAGGACTTT pLKO_005 1782 3UTR 100% 4.950 3.465 N Arrb1 n/a
5 TRCN0000075647 TCTCAAAGAAAGGCGAGTCTA pLKO.1 418 3UTR 100% 4.950 3.465 N Arrb1 n/a
6 TRCN0000327473 TCTCAAAGAAAGGCGAGTCTA pLKO_005 418 3UTR 100% 4.950 3.465 N Arrb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_378207.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00106 pDONR223 100% 58.4% None (many diffs) n/a
2 ccsbBroad304_00106 pLX_304 0% 58.4% V5 (many diffs) n/a
3 TRCN0000471594 GGTGCGTGGTTTCTTTATATCATA pLX_317 29.6% 58.4% V5 (many diffs) n/a
Download CSV