Transcript: Mouse XR_380971.2

PREDICTED: Mus musculus von Willebrand factor C domain containing 2 (Vwc2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vwc2 (319922)
Length:
2333
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_380971.2
NBCI Gene record:
Vwc2 (319922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_380971.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098023 GAGAATTGAACGGCAAGCCAT pLKO.1 1666 3UTR 100% 2.640 2.112 N Vwc2 n/a
2 TRCN0000098024 CGAGACATGAGTGCAGACAAA pLKO.1 1692 3UTR 100% 4.950 3.465 N Vwc2 n/a
3 TRCN0000098022 GAAGAAGAACTACTGCGAGTT pLKO.1 1378 3UTR 100% 4.050 2.835 N Vwc2 n/a
4 TRCN0000098021 GCACCATATGTCACTGCACTT pLKO.1 1629 3UTR 100% 0.000 0.000 N Vwc2 n/a
5 TRCN0000155935 CCATGTGCACGAGACATGAAT pLKO.1 1683 3UTR 100% 0.563 0.450 N VWC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_380971.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05550 pDONR223 100% 36.9% None (many diffs) n/a
2 ccsbBroad304_05550 pLX_304 0% 36.9% V5 (many diffs) n/a
3 TRCN0000477460 CAAGGCACCCCGAGATTTTGCACT pLX_317 45.1% 36.9% V5 (many diffs) n/a
Download CSV