Transcript: Mouse XR_381529.3

PREDICTED: Mus musculus breast cancer metastasis-suppressor 1-like (Brms1l), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Brms1l (52592)
Length:
2513
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_381529.3
NBCI Gene record:
Brms1l (52592)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_381529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039348 TCGTTGTCTCAGGTCCATATA pLKO.1 786 3UTR 100% 13.200 10.560 N Brms1l n/a
2 TRCN0000039346 GACAGTTCAGAAATGGATGAT pLKO.1 308 3UTR 100% 4.950 3.465 N Brms1l n/a
3 TRCN0000039347 TCTGTGAAGAACAAGTACGAA pLKO.1 563 3UTR 100% 3.000 2.100 N Brms1l n/a
4 TRCN0000039345 CCAAGAAGTCATAGCTGGAAA pLKO.1 448 3UTR 100% 4.950 2.970 N Brms1l n/a
5 TRCN0000135586 GCTTTACATTTCACAGCTACA pLKO.1 1096 3UTR 100% 4.050 2.025 Y BRMS1L n/a
6 TRCN0000135639 GAGAAGATAAGAAGGCTTGAA pLKO.1 662 3UTR 100% 4.950 3.465 N BRMS1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_381529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04372 pDONR223 100% 34.9% None (many diffs) n/a
2 ccsbBroad304_04372 pLX_304 0% 34.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000471040 AAATGGCGGTGGGAAATTCTTAAG pLX_317 39% 34.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV