Construct: ORF TRCN0000471040
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011622.1_s317c1
- Derived from:
- ccsbBroadEn_04372
- DNA Barcode:
- AAATGGCGGTGGGAAATTCTTAAG
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BRMS1L (84312)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471040
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84312 | BRMS1L | BRMS1 like transcriptional ... | NM_032352.4 | 100% | 100% | |
| 2 | human | 84312 | BRMS1L | BRMS1 like transcriptional ... | XM_005268128.1 | 97.8% | 97.5% | 728_748del |
| 3 | human | 84312 | BRMS1L | BRMS1 like transcriptional ... | XM_006720275.2 | 85.1% | 85.1% | 0_1ins144 |
| 4 | human | 84312 | BRMS1L | BRMS1 like transcriptional ... | XM_017021704.2 | 85.1% | 85.1% | 0_1ins144 |
| 5 | human | 84312 | BRMS1L | BRMS1 like transcriptional ... | XM_017021705.1 | 85.1% | 85.1% | 0_1ins144 |
| 6 | human | 84312 | BRMS1L | BRMS1 like transcriptional ... | XM_006720274.2 | 83.3% | 83% | 0_1ins144;584_604del |
| 7 | human | 84312 | BRMS1L | BRMS1 like transcriptional ... | XM_017021703.1 | 83.3% | 83% | 0_1ins144;584_604del |
| 8 | mouse | 52592 | Brms1l | breast cancer metastasis-su... | NM_001037756.2 | 90.7% | 99.6% | (many diffs) |
| 9 | mouse | 52592 | Brms1l | breast cancer metastasis-su... | XR_381529.3 | 34.9% | (many diffs) | |
| 10 | mouse | 52592 | Brms1l | breast cancer metastasis-su... | XR_381530.3 | 29.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1035
- ORF length:
- 969
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc agtccattcc cgaggggata agaaggagac caaccatcac gatgagatgg 121 aggtggacta cgccgaaaat gaggggagca gctccgagga cgaggacact gagagctcgt 181 cggtctccga ggatggagat agctcagaaa tggatgatga agactgtgaa agaagaagaa 241 tggaatgttt ggatgaaatg tccaatcttg aaaaacagtt taccgatctc aaagatcaac 301 tttataaaga acgattaagt caggtggatg caaaactaca agaagtcata gctggaaaag 361 caccagaata cttggaaccg ctggcaactt tacaggaaaa tatgcaaatt cgtacaaagg 421 tagcaggaat ctatagagag ctctgcttag aatctgtaaa gaacaaatat gaatgtgaaa 481 ttcaagcttc tcgccagcat tgtgagagcg aaaagctgtt gctatatgat acagtccaga 541 gtgaactaga ggagaagata agaaggcttg aagaggatag gcacagcatt gatattacct 601 cagagctgtg gaatgatgag cttcagtcaa gaaaaaagag gaaggatcct ttcagtccTG 661 ACAAAAAGAA GCCAGTTGTT GTTTCAGGTC CATATATAGT TTATATGCTA CAAGATCTTG 721 ATATTCTTGA AGACTGGACA ACAATTAGGA AGGCAATGGC TACATTGGGG CCACACAGAG 781 TGAAAACGGA ACCACCTGTG AAACTGGAAA AACATCTGCA CAGTGCTAGA TCTGAAGAGG 841 GAAGACTATA TTATGATGGT GAATGGTATA TACGTGGACA AACAATATGT ATTGATAAAA 901 AAGATGAATG TCCTACAAGT GCTGTAATTA CAACAATTAA CCATGATGAA GTTTGGTTTA 961 AGAGGCCTGA TGGAAGCAAA TCTAAGCTTT ACATTTCACA GCTACAGAAA GGAAAATATT 1021 CAATTAAACA TTCATACCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC 1081 TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT 1141 TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA AATGGCGGTG GGAAATTCTT 1201 AAGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag att