Transcript: Mouse XR_381552.2

PREDICTED: Mus musculus protein phosphatase 4, regulatory subunit 4 (Ppp4r4), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp4r4 (74521)
Length:
3383
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_381552.2
NBCI Gene record:
Ppp4r4 (74521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_381552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250649 TCGCGTTTAGTTAGCTGTAAA pLKO_005 787 3UTR 100% 13.200 18.480 N Ppp4r4 n/a
2 TRCN0000250650 TGTGGTGCTTCCCGAACTAAT pLKO_005 972 3UTR 100% 13.200 18.480 N Ppp4r4 n/a
3 TRCN0000217464 GACTCATTCCGAACTCGAAAT pLKO.1 2674 3UTR 100% 10.800 15.120 N Ppp4r4 n/a
4 TRCN0000183168 GCACCATTTGTACTAATGCTA pLKO.1 3089 3UTR 100% 3.000 4.200 N Ppp4r4 n/a
5 TRCN0000250651 ATATCGAGTGACCAGATTTAT pLKO_005 1771 3UTR 100% 15.000 12.000 N Ppp4r4 n/a
6 TRCN0000250652 GATGTGAAACTTGCCCTATTT pLKO_005 2963 3UTR 100% 13.200 9.240 N Ppp4r4 n/a
7 TRCN0000182996 CCAGATTTATTACCGTTTCTT pLKO.1 1782 3UTR 100% 5.625 3.938 N Ppp4r4 n/a
8 TRCN0000215543 GATGACAGAAGTCAAACTATA pLKO.1 1075 3UTR 100% 13.200 7.920 N Ppp4r4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_381552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03846 pDONR223 100% 68.6% None (many diffs) n/a
2 ccsbBroad304_03846 pLX_304 0% 68.6% V5 (many diffs) n/a
3 TRCN0000480615 CAACTTTTTCAAAAGAATTGGTGC pLX_317 17.5% 68.6% V5 (many diffs) n/a
Download CSV