Transcript: Mouse XR_383170.2

PREDICTED: Mus musculus tudor domain containing 3 (Tdrd3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tdrd3 (219249)
Length:
2803
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_383170.2
NBCI Gene record:
Tdrd3 (219249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_383170.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123757 GCAAGAACGAAGGTGTCTATA pLKO.1 1055 3UTR 100% 13.200 18.480 N Tdrd3 n/a
2 TRCN0000123758 GCCAGAAGTAATCTCAATATT pLKO.1 973 3UTR 100% 15.000 12.000 N Tdrd3 n/a
3 TRCN0000366890 TCAGCACCAAGCACGTTATTT pLKO_005 1306 3UTR 100% 15.000 12.000 N Tdrd3 n/a
4 TRCN0000366888 GGTGAAGTGGAACACCTAATT pLKO_005 679 3UTR 100% 13.200 10.560 N Tdrd3 n/a
5 TRCN0000366942 AGCTGTGCCCTACGATGATAA pLKO_005 2052 3UTR 100% 13.200 9.240 N Tdrd3 n/a
6 TRCN0000375869 TGGAAGCCCACTGATAGATTT pLKO_005 2590 3UTR 100% 13.200 9.240 N Tdrd3 n/a
7 TRCN0000123754 GAGACTCAATATGCTGGATAT pLKO.1 2627 3UTR 100% 10.800 7.560 N Tdrd3 n/a
8 TRCN0000375784 TCACGGACTACGGCAACTATG pLKO_005 2273 3UTR 100% 10.800 7.560 N Tdrd3 n/a
9 TRCN0000123755 CCACGGACAATGAATAGTGAA pLKO.1 1876 3UTR 100% 4.950 3.465 N Tdrd3 n/a
10 TRCN0000123756 CGGCAGTAGAATTCAGTTATA pLKO.1 545 3UTR 100% 0.000 0.000 N Tdrd3 n/a
11 TRCN0000375856 CAAGTGTGACAGGCCATATTC pLKO_005 1629 3UTR 100% 13.200 7.920 N Tdrd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_383170.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04235 pDONR223 100% 59.2% None (many diffs) n/a
2 ccsbBroad304_04235 pLX_304 0% 59.2% V5 (many diffs) n/a
3 TRCN0000479596 AACCGTCCCGTTAGTCGCAACCCA pLX_317 16.6% 59.2% V5 (many diffs) n/a
Download CSV