Transcript: Mouse XR_384025.3

PREDICTED: Mus musculus chromobox 7 (Cbx7), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cbx7 (52609)
Length:
3372
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_384025.3
NBCI Gene record:
Cbx7 (52609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_384025.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019145 GTATAGGAAGAGAGGTCCGAA pLKO.1 494 3UTR 100% 2.640 3.696 N CBX7 n/a
2 TRCN0000096733 CGTGACTGACATCACCGCCAA pLKO.1 953 3UTR 100% 0.720 1.008 N Cbx7 n/a
3 TRCN0000096730 CGGAAGGGCAAAGTTGAATAT pLKO.1 354 3UTR 100% 13.200 9.240 N Cbx7 n/a
4 TRCN0000236359 ATAGGAAGAGAGGTCCGAAAC pLKO_005 496 3UTR 100% 6.000 4.200 N CBX7 n/a
5 TRCN0000096729 CCTGAATGTATTGGGAGGAAT pLKO.1 3176 3UTR 100% 4.950 3.465 N Cbx7 n/a
6 TRCN0000096732 GCAAAGTTGAATATCTGGTGA pLKO.1 361 3UTR 100% 2.640 1.848 N Cbx7 n/a
7 TRCN0000096731 CCTCAAGTGAAGTTACCGTGA pLKO.1 937 3UTR 100% 2.160 1.512 N Cbx7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_384025.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07890 pDONR223 100% 20.1% None (many diffs) n/a
2 ccsbBroad304_07890 pLX_304 0% 20.1% V5 (many diffs) n/a
3 TRCN0000465729 AAACCAAGTACTCCTGGCATAGAG pLX_317 51.2% 20.1% V5 (many diffs) n/a
Download CSV