Transcript: Mouse XR_384352.1

PREDICTED: Mus musculus predicted gene, 30181 (Gm30181), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm30181 (102631998)
Length:
893
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_384352.1
NBCI Gene record:
Gm30181 (102631998)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_384352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055188 GCTTGATCTTAGGGATGATAA pLKO.1 396 3UTR 100% 13.200 6.600 Y Rac1 n/a
2 TRCN0000301589 GCTTGATCTTAGGGATGATAA pLKO_005 396 3UTR 100% 13.200 6.600 Y Rac1 n/a
3 TRCN0000055192 CCAATGTTATGGTAGATGGAA pLKO.1 173 3UTR 100% 3.000 1.500 Y Rac1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_384352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15559 pDONR223 0% 55.3% None (many diffs) n/a
2 ccsbBroad304_15559 pLX_304 0% 55.3% V5 (many diffs) n/a
3 ccsbBroadEn_06831 pDONR223 100% 55.2% None (many diffs) n/a
4 ccsbBroad304_06831 pLX_304 98.4% 55.2% V5 (many diffs) n/a
5 TRCN0000474978 TTAGGGTTTGTATCGAAATGACCC pLX_317 92.9% 55.2% V5 (many diffs) n/a
Download CSV