Transcript: Mouse XR_384567.3

PREDICTED: Mus musculus ATP-binding cassette, sub-family F (GCN20), member 3 (Abcf3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abcf3 (27406)
Length:
3089
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_384567.3
NBCI Gene record:
Abcf3 (27406)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_384567.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159846 GATGTGCGAATTGAGAACTTT pLKO.1 646 3UTR 100% 5.625 7.875 N ABCF3 n/a
2 TRCN0000113484 GAACCCACAAACATGCTGGAT pLKO.1 1174 3UTR 100% 2.640 2.112 N Abcf3 n/a
3 TRCN0000326265 GAACCCACAAACATGCTGGAT pLKO_005 1174 3UTR 100% 2.640 2.112 N Abcf3 n/a
4 TRCN0000113480 GACAGCCTTATTTCCCAAATT pLKO.1 2378 3UTR 100% 13.200 9.240 N Abcf3 n/a
5 TRCN0000326320 GACAGCCTTATTTCCCAAATT pLKO_005 2378 3UTR 100% 13.200 9.240 N Abcf3 n/a
6 TRCN0000113483 GCCTCTCAAGTGCAGAGTAAA pLKO.1 1491 3UTR 100% 13.200 9.240 N Abcf3 n/a
7 TRCN0000326267 GCCTCTCAAGTGCAGAGTAAA pLKO_005 1491 3UTR 100% 13.200 9.240 N Abcf3 n/a
8 TRCN0000113481 CCCACAAACATGCTGGATGTA pLKO.1 1177 3UTR 100% 4.950 3.465 N Abcf3 n/a
9 TRCN0000113482 CCCAACTTCTATATTCTGGAT pLKO.1 2025 3UTR 100% 2.640 1.848 N Abcf3 n/a
10 TRCN0000326322 CCCAACTTCTATATTCTGGAT pLKO_005 2025 3UTR 100% 2.640 1.848 N Abcf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_384567.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488888 GCCATTAACGTCTCTTCACTGTTT pLX_317 18% 61.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488877 CTCTCATAAGCGCCTAACGGTCAC pLX_317 15.8% 60.9% V5 (many diffs) n/a
3 ccsbBroadEn_03580 pDONR223 100% 60.9% None (many diffs) n/a
4 ccsbBroad304_03580 pLX_304 0% 60.9% V5 (many diffs) n/a
5 TRCN0000471938 AGGCACGCAGACTTAGCCCTCGGG pLX_317 17.7% 60.9% V5 (many diffs) n/a
6 ccsbBroadEn_08518 pDONR223 100% 60.9% None (many diffs) n/a
7 ccsbBroad304_08518 pLX_304 0% 60.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV