Transcript: Mouse XR_385316.3

PREDICTED: Mus musculus zinc finger protein 523 (Zfp523), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp523 (224656)
Length:
3083
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385316.3
NBCI Gene record:
Zfp523 (224656)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385316.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096412 CGCCACCAACTACAAGAATCA pLKO.1 1583 3UTR 100% 4.950 6.930 N Zfp523 n/a
2 TRCN0000096411 CCAACCCACATTGCTTACCTT pLKO.1 1890 3UTR 100% 3.000 4.200 N Zfp523 n/a
3 TRCN0000096409 CCACCACCACAGTCAGAATTA pLKO.1 2851 3UTR 100% 13.200 9.240 N Zfp523 n/a
4 TRCN0000096410 GCCACCAACTACAAGAATCAT pLKO.1 1584 3UTR 100% 5.625 3.938 N Zfp523 n/a
5 TRCN0000096413 CATCACTTAAAGGTCCACGAA pLKO.1 1227 3UTR 100% 2.640 1.848 N Zfp523 n/a
6 TRCN0000233079 TCACCAGCGCCACCAACTATA pLKO_005 1576 3UTR 100% 13.200 9.240 N ZNF76 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385316.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01806 pDONR223 100% 49.1% None (many diffs) n/a
2 ccsbBroad304_01806 pLX_304 0% 49.1% V5 (many diffs) n/a
3 TRCN0000478143 GGAATGATGAAACTACCTCACAGC pLX_317 9.9% 49.1% V5 (many diffs) n/a
Download CSV