Transcript: Mouse XR_385326.1

PREDICTED: Mus musculus fibronectin type 3 and SPRY domain-containing protein (Fsd1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fsd1 (240121)
Length:
1761
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385326.1
NBCI Gene record:
Fsd1 (240121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433899 CCTTCCGACTATCGCTCAAAG pLKO_005 563 3UTR 100% 10.800 15.120 N Fsd1 n/a
2 TRCN0000098183 CGACAATATGAGTCACCTCAT pLKO.1 594 3UTR 100% 0.405 0.567 N Fsd1 n/a
3 TRCN0000445434 GGAGTACCGCAAGACCAATTT pLKO_005 777 3UTR 100% 13.200 9.240 N Fsd1 n/a
4 TRCN0000437142 GTGCCACTAGCAGTTCCAATA pLKO_005 1596 3UTR 100% 10.800 7.560 N Fsd1 n/a
5 TRCN0000098181 GCCGCCAAGGAAATCAAAGAT pLKO.1 523 3UTR 100% 5.625 3.938 N Fsd1 n/a
6 TRCN0000098182 GACAGCAAGATCGACCACTAT pLKO.1 751 3UTR 100% 4.950 3.465 N Fsd1 n/a
7 TRCN0000098180 CCAGGCCATCTACCAGCTGGG pLKO.1 1632 3UTR 100% 0.000 0.000 N Fsd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12557 pDONR223 100% 43.5% None (many diffs) n/a
2 ccsbBroad304_12557 pLX_304 0% 43.5% V5 (many diffs) n/a
3 TRCN0000471389 AGCTGGATCATAGTTCCGTCGTGC pLX_317 49.9% 43.5% V5 (many diffs) n/a
Download CSV