Transcript: Mouse XR_386014.3

PREDICTED: Mus musculus dymeclin (Dym), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dym (69190)
Length:
2441
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_386014.3
NBCI Gene record:
Dym (69190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_386014.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219621 ATGTCTATATGGCCCTTATAA pLKO.1 1515 3UTR 100% 15.000 21.000 N Dym n/a
2 TRCN0000176128 GTGTACGCCTTGCTTTACAAA pLKO.1 1894 3UTR 100% 5.625 7.875 N Dym n/a
3 TRCN0000193324 CCATTTCAGTTTGCAAGTCTT pLKO.1 507 3UTR 100% 4.950 6.930 N Dym n/a
4 TRCN0000193180 CATTTCAGTTTGCAAGTCTTT pLKO.1 508 3UTR 100% 4.950 3.960 N Dym n/a
5 TRCN0000173622 GCCTCCTAATTCTGGTGGTAA pLKO.1 1647 3UTR 100% 4.950 3.960 N Dym n/a
6 TRCN0000173509 GCTTTACAAACGGGACCTCTT pLKO.1 1905 3UTR 100% 4.050 3.240 N Dym n/a
7 TRCN0000193081 CAGTGTCATTGAAGAAGTGAT pLKO.1 1809 3UTR 100% 4.950 3.465 N Dym n/a
8 TRCN0000173391 GCAGACACACAATGCTCTGTT pLKO.1 640 3UTR 100% 4.950 3.465 N Dym n/a
9 TRCN0000193818 CATCAGTCACAAGTACCTGAT pLKO.1 925 3UTR 100% 0.405 0.243 N Dym n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_386014.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08410 pDONR223 100% 64.4% None (many diffs) n/a
2 ccsbBroad304_08410 pLX_304 0% 64.4% V5 (many diffs) n/a
3 TRCN0000475275 GAATCTTAACCAGAACTAATTATC pLX_317 23% 64.4% V5 (many diffs) n/a
Download CSV