Transcript: Mouse XR_387772.4

PREDICTED: Mus musculus phenylalanyl-tRNA synthetase, alpha subunit (Farsa), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Farsa (66590)
Length:
1877
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387772.4
NBCI Gene record:
Farsa (66590)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387772.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076310 CCGCTCTCAGTTCCGACAAAT pLKO.1 756 3UTR 100% 13.200 18.480 N Farsa n/a
2 TRCN0000287577 CCGCTCTCAGTTCCGACAAAT pLKO_005 756 3UTR 100% 13.200 18.480 N Farsa n/a
3 TRCN0000294983 TTGGCAGTGACCTACTATTTA pLKO_005 1668 3UTR 100% 15.000 10.500 N Farsa n/a
4 TRCN0000076312 CTGACGGAAGTGATCCTGAAA pLKO.1 559 3UTR 100% 4.950 3.465 N Farsa n/a
5 TRCN0000287495 CTGACGGAAGTGATCCTGAAA pLKO_005 559 3UTR 100% 4.950 3.465 N Farsa n/a
6 TRCN0000076311 CTTCAGCACAAGCGTGTCTAA pLKO.1 606 3UTR 100% 4.950 3.465 N Farsa n/a
7 TRCN0000287579 CTTCAGCACAAGCGTGTCTAA pLKO_005 606 3UTR 100% 4.950 3.465 N Farsa n/a
8 TRCN0000076309 CCGACAAATCTTCTTGGAGAT pLKO.1 768 3UTR 100% 4.050 2.835 N Farsa n/a
9 TRCN0000287578 CCGACAAATCTTCTTGGAGAT pLKO_005 768 3UTR 100% 4.050 2.835 N Farsa n/a
10 TRCN0000045903 GCCATGTCCAACAAGTGGATT pLKO.1 385 3UTR 100% 4.950 3.465 N FARSA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387772.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00540 pDONR223 100% 69.6% None (many diffs) n/a
2 ccsbBroad304_00540 pLX_304 0% 69.6% V5 (many diffs) n/a
Download CSV