Transcript: Mouse XR_387774.3

PREDICTED: Mus musculus RIKEN cDNA 2310036O22 gene (2310036O22Rik), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trir (68544)
Length:
634
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387774.3
NBCI Gene record:
Trir (68544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123868 TCCAGCGGTGTGAACTTGTTT pLKO.1 232 3UTR 100% 5.625 7.875 N Trir n/a
2 TRCN0000354174 TCCAGCGGTGTGAACTTGTTT pLKO_005 232 3UTR 100% 5.625 7.875 N Trir n/a
3 TRCN0000074484 CGGAGGATGAGGTATTAACAA pLKO.1 607 3UTR 100% 5.625 4.500 N TRIR n/a
4 TRCN0000123866 CGGGAACAAACTAGCCCTCAA pLKO.1 557 3UTR 100% 4.050 3.240 N Trir n/a
5 TRCN0000327263 CGGGAACAAACTAGCCCTCAA pLKO_005 557 3UTR 100% 4.050 3.240 N Trir n/a
6 TRCN0000123865 GTGAACTTGTTTGCCAACGAT pLKO.1 241 3UTR 100% 3.000 2.400 N Trir n/a
7 TRCN0000351939 GTGAACTTGTTTGCCAACGAT pLKO_005 241 3UTR 100% 3.000 2.400 N Trir n/a
8 TRCN0000074486 AGACGGAGGATGAGGTATTAA pLKO.1 604 3UTR 100% 15.000 10.500 N TRIR n/a
9 TRCN0000074487 GACGGGAATAGTAGCCAAGAA pLKO.1 578 3UTR 100% 4.950 3.465 N TRIR n/a
10 TRCN0000437696 GCTGTTCAAGCGGAAGATGGA pLKO_005 276 3UTR 100% 2.640 1.848 N TRIR n/a
11 TRCN0000123867 CCCAGGGAATCCGAAGAGGAA pLKO.1 375 3UTR 100% 0.880 0.616 N Trir n/a
12 TRCN0000327262 CCCAGGGAATCCGAAGAGGAA pLKO_005 375 3UTR 100% 0.880 0.616 N Trir n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08904 pDONR223 100% 53.4% None (many diffs) n/a
2 ccsbBroad304_08904 pLX_304 0% 53.4% V5 (many diffs) n/a
3 TRCN0000479037 TTTTGATAGCTGTGACGACCTTCA pLX_317 74.2% 53.4% V5 (many diffs) n/a
Download CSV