Transcript: Mouse XR_388420.2

PREDICTED: Mus musculus lethal giant larvae homolog 2 (Drosophila) (Llgl2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Llgl2 (217325)
Length:
4029
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388420.2
NBCI Gene record:
Llgl2 (217325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087881 CTCTATACCTTACGGTCCCTT pLKO.1 1012 3UTR 100% 2.640 2.112 N Llgl2 n/a
2 TRCN0000087882 CAGCAGAGTGTCCAGTCATAA pLKO.1 2176 3UTR 100% 13.200 9.240 N Llgl2 n/a
3 TRCN0000087878 CTGTGGGATGATCACACACTA pLKO.1 3740 3UTR 100% 4.950 3.465 N Llgl2 n/a
4 TRCN0000087880 GCCAAGGTTTCTATCTGATAT pLKO.1 2925 3UTR 100% 13.200 7.920 N Llgl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06527 pDONR223 100% 66.2% None (many diffs) n/a
2 ccsbBroad304_06527 pLX_304 0% 66.2% V5 (many diffs) n/a
3 TRCN0000480479 AGCTAAATCTCACTGTGTCTCTTC pLX_317 12% 66.2% V5 (many diffs) n/a
Download CSV