Transcript: Mouse XR_390324.2

PREDICTED: Mus musculus F-box and leucine-rich repeat protein 4 (Fbxl4), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxl4 (269514)
Length:
1987
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_390324.2
NBCI Gene record:
Fbxl4 (269514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_390324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086661 CGTCAGTTTAAACCTTGTATT pLKO.1 879 3UTR 100% 13.200 18.480 N Fbxl4 n/a
2 TRCN0000086660 CCCAAATCTACAAGACTTAAA pLKO.1 1514 3UTR 100% 13.200 10.560 N Fbxl4 n/a
3 TRCN0000086659 GCCCAAATCTACAAGACTTAA pLKO.1 1513 3UTR 100% 13.200 9.240 N Fbxl4 n/a
4 TRCN0000118341 GCCAGGACTATGTGGAACTTA pLKO.1 682 3UTR 100% 5.625 3.938 N FBXL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_390324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02936 pDONR223 100% 63.9% None (many diffs) n/a
2 ccsbBroad304_02936 pLX_304 0% 63.9% V5 (many diffs) n/a
3 TRCN0000479278 ATAAATAATATTGACGATCGAGTG pLX_317 22.4% 63.9% V5 (many diffs) n/a
Download CSV