Transcript: Human XR_427296.2

PREDICTED: Homo sapiens tRNA splicing endonuclease subunit 2 (TSEN2), transcript variant X23, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSEN2 (80746)
Length:
1887
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_427296.2
NBCI Gene record:
TSEN2 (80746)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_427296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435843 TATAGGATCTTTGAGTATTTG pLKO_005 950 3UTR 100% 13.200 18.480 N TSEN2 n/a
2 TRCN0000414455 GATCCTAAACTGGTTGCTAAA pLKO_005 323 3UTR 100% 10.800 15.120 N TSEN2 n/a
3 TRCN0000051822 CCTTGAGCAGAGTTTCCGTTA pLKO.1 1106 3UTR 100% 4.050 5.670 N TSEN2 n/a
4 TRCN0000051819 CCGTGCTGAAATGATTAACAA pLKO.1 199 3UTR 100% 5.625 4.500 N TSEN2 n/a
5 TRCN0000421894 TTGTTGTAATCGTCCATTAAT pLKO_005 1354 3UTR 100% 15.000 10.500 N TSEN2 n/a
6 TRCN0000414820 GAGTGACCAAGACGATCTTTA pLKO_005 1266 3UTR 100% 13.200 9.240 N TSEN2 n/a
7 TRCN0000051821 CAGGTTAATATGCAGAAGAAA pLKO.1 925 3UTR 100% 5.625 3.938 N TSEN2 n/a
8 TRCN0000051818 CCATGCAAGTTATTCTGTCAT pLKO.1 1017 3UTR 100% 4.950 3.465 N TSEN2 n/a
9 TRCN0000051820 GCAGCTCTATGGGAAAGGTTA pLKO.1 253 3UTR 100% 4.950 3.465 N TSEN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_427296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09043 pDONR223 100% 57.9% None (many diffs) n/a
2 ccsbBroad304_09043 pLX_304 0% 57.9% V5 (many diffs) n/a
3 TRCN0000466980 ATAGACGTTACGCATTAGAGGAGG pLX_317 24.2% 57.9% V5 (many diffs) n/a
Download CSV