Transcript: Human XR_428168.3

PREDICTED: Homo sapiens ring finger protein 32 (RNF32), transcript variant X17, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF32 (140545)
Length:
988
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_428168.3
NBCI Gene record:
RNF32 (140545)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_428168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434613 CATGATCTTCAACTTCGAAAT pLKO_005 313 3UTR 100% 10.800 7.560 N RNF32 n/a
2 TRCN0000034108 GAGAGGATGTGTTGTTAGAAA pLKO.1 769 3UTR 100% 5.625 3.938 N RNF32 n/a
3 TRCN0000034105 CCCAAACTAGAAGACTCAGAA pLKO.1 445 3UTR 100% 4.950 3.465 N RNF32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_428168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14386 pDONR223 100% 64.3% None (many diffs) n/a
2 ccsbBroad304_14386 pLX_304 0% 64.3% V5 (many diffs) n/a
3 TRCN0000473770 CTGTGGCTAACTTGGAGCGGCTAC pLX_317 62.4% 64.3% V5 (many diffs) n/a
4 ccsbBroadEn_13201 pDONR223 100% 62.1% None 1_234del;684_685ins56;884_988del n/a
5 ccsbBroad304_13201 pLX_304 0% 62.1% V5 1_234del;684_685ins56;884_988del n/a
6 TRCN0000469877 TTACACTTCTAATATACCATCCTT pLX_317 57.5% 62.1% V5 1_234del;684_685ins56;884_988del n/a
7 TRCN0000487699 GAATAAAGAGTCCCGAAAGTGAGT pLX_317 34.3% 62.1% V5 (not translated due to prior stop codon) 1_234del;684_685ins56;884_988del n/a
Download CSV