Transcript: Human XR_429323.3

PREDICTED: Homo sapiens MOK protein kinase (MOK), transcript variant X14, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MOK (5891)
Length:
1795
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_429323.3
NBCI Gene record:
MOK (5891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_429323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001715 ACCTCTACTAACAACCAATTT pLKO.1 927 3UTR 100% 13.200 18.480 N MOK n/a
2 TRCN0000196383 GCACTATATGTACCAGTTATG pLKO.1 541 3UTR 100% 10.800 15.120 N MOK n/a
3 TRCN0000001717 CGGCTGTGTGTTCTACGAGAT pLKO.1 787 3UTR 100% 4.050 5.670 N MOK n/a
4 TRCN0000001714 CTGGTTCTCTTGCACTAATAT pLKO.1 447 3UTR 100% 15.000 10.500 N MOK n/a
5 TRCN0000361679 CTGGTTCTCTTGCACTAATAT pLKO_005 447 3UTR 100% 15.000 10.500 N Mok n/a
6 TRCN0000001716 CTGGGCTAATATACTTGTAAA pLKO.1 1519 3UTR 100% 13.200 9.240 N MOK n/a
7 TRCN0000195631 CGAGGGAGAAGATACCCATTA pLKO.1 503 3UTR 100% 10.800 7.560 N MOK n/a
8 TRCN0000199597 GTGGTCAGACTGTCGTCTTAC pLKO.1 1140 3UTR 100% 10.800 7.560 N MOK n/a
9 TRCN0000196954 GCAGCGCTTTGAAAGTATTGA pLKO.1 331 3UTR 100% 5.625 3.938 N MOK n/a
10 TRCN0000001713 CAAGAAGACAGATCCGCAGAA pLKO.1 1247 3UTR 100% 4.050 2.835 N MOK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_429323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487807 GCAGCCTTTTTAGATATATGGCCC pLX_317 24.9% 50.8% V5 (many diffs) n/a
2 TRCN0000491430 TCATCCCTGACAGACCTTTTAGAT pLX_317 25.1% 50.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14824 pDONR223 0% 38.6% None 1_223del;917_1795del n/a
4 ccsbBroad304_14824 pLX_304 0% 38.6% V5 1_223del;917_1795del n/a
5 TRCN0000472348 TGGACGGTGAACCATGGTTTGCCT pLX_317 47.2% 38.6% V5 1_223del;917_1795del n/a
6 ccsbBroadEn_13939 pDONR223 100% 38.5% None 1_223del;527_528insAAA;917_1795del n/a
7 ccsbBroad304_13939 pLX_304 0% 38.5% V5 1_223del;527_528insAAA;917_1795del n/a
8 TRCN0000466053 ACTCATTGTGTTAAGAACACACCT pLX_317 45.9% 38.5% V5 1_223del;527_528insAAA;917_1795del n/a
Download CSV