Transcript: Mouse XR_868409.2

PREDICTED: Mus musculus predicted pseudogene 7931 (Gm7931), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm7931 (100503799)
Length:
1184
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_868409.2
NBCI Gene record:
Gm7931 (100503799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_868409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108988 TCTGCGAGGTTGTCTGCTAAA pLKO.1 193 3UTR 100% 10.800 5.400 Y Hmgn2 n/a
2 TRCN0000018552 GACCAGGCACAGAAAGCTGAA pLKO.1 352 3UTR 100% 4.050 2.025 Y HMGN2 n/a
3 TRCN0000108989 GATGCGAATAATCCTGCAGAA pLKO.1 313 3UTR 100% 4.050 2.025 Y Hmgn2 n/a
4 TRCN0000108987 CCCTGCGAAGAAGGGAGAGAA pLKO.1 252 3UTR 100% 1.650 0.825 Y Hmgn2 n/a
5 TRCN0000108985 GCATTGAATGAAGACTTCATT pLKO.1 1016 3UTR 100% 0.563 0.281 Y Hmgn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_868409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00754 pDONR223 100% 21.1% None (many diffs) n/a
2 ccsbBroad304_00754 pLX_304 0% 21.1% V5 (many diffs) n/a
3 TRCN0000465397 CGTGTAGCACCTTCTGGCTCTCTA pLX_317 100% 21.1% V5 (many diffs) n/a
Download CSV