Transcript: Mouse XR_868560.2

PREDICTED: Mus musculus huntingtin interacting protein 1 (Hip1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hip1 (215114)
Length:
2863
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_868560.2
NBCI Gene record:
Hip1 (215114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_868560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380362 ACAGAGGTATAGCAAGTTAAA pLKO_005 1659 3UTR 100% 13.200 18.480 N Hip1 n/a
2 TRCN0000381712 ACGAGAAGGACCACTTGATTG pLKO_005 1376 3UTR 100% 10.800 15.120 N Hip1 n/a
3 TRCN0000381433 AGCGTCAATAAGGCCATTAAT pLKO_005 391 3UTR 100% 15.000 10.500 N Hip1 n/a
4 TRCN0000379881 ACAAGTTTGATGACGTCTTTG pLKO_005 1298 3UTR 100% 10.800 7.560 N Hip1 n/a
5 TRCN0000381275 AGTACTTCAAGCGGCTCATTC pLKO_005 1103 3UTR 100% 10.800 7.560 N Hip1 n/a
6 TRCN0000381809 GGCCGGAGAAAGTGACGTTAA pLKO_005 780 3UTR 100% 10.800 7.560 N Hip1 n/a
7 TRCN0000100197 CAGGCTAATGAACAGAGGTAT pLKO.1 1648 3UTR 100% 4.950 3.465 N Hip1 n/a
8 TRCN0000100198 GCTGAGAACAAGGATGGAGTA pLKO.1 699 3UTR 100% 4.050 2.835 N Hip1 n/a
9 TRCN0000100196 CCAGGCTAATGAACAGAGGTA pLKO.1 1647 3UTR 100% 2.640 1.848 N Hip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_868560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06366 pDONR223 100% 64% None (many diffs) n/a
2 ccsbBroad304_06366 pLX_304 0% 64% V5 (many diffs) n/a
3 TRCN0000470225 GGCGCGTCTAACTGGCTTTCCGAC pLX_317 15.8% 64% V5 (many diffs) n/a
Download CSV