Transcript: Mouse XR_868844.2

PREDICTED: Mus musculus LIM domain only 3 (Lmo3), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lmo3 (109593)
Length:
794
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_868844.2
NBCI Gene record:
Lmo3 (109593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_868844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113536 CGAAGGCTAACCTTATCCTTT pLKO.1 323 3UTR 100% 4.950 6.930 N Lmo3 n/a
2 TRCN0000113539 CGCTGCCTGTAGCAAGCTCAT pLKO.1 387 3UTR 100% 1.350 1.890 N Lmo3 n/a
3 TRCN0000113537 CAGAGACTATCTGAGGCTGTT pLKO.1 348 3UTR 100% 4.050 2.835 N Lmo3 n/a
4 TRCN0000113538 AGGCCTCATGAAAGAAGGCTA pLKO.1 772 3UTR 100% 2.640 1.848 N Lmo3 n/a
5 TRCN0000016253 CTGGACAAATACTGGCATGAA pLKO.1 241 3UTR 100% 4.950 2.970 N LMO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_868844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03676 pDONR223 100% 48.6% None (many diffs) n/a
2 ccsbBroad304_03676 pLX_304 0% 48.6% V5 (many diffs) n/a
3 TRCN0000467106 AGCGATGATACCCTAACGCCTAGG pLX_317 70.9% 48.6% V5 (many diffs) n/a
Download CSV