Transcript: Mouse XR_869418.1

PREDICTED: Mus musculus predicted pseudogene 8430 (Gm8430), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm8430 (667035)
Length:
620
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_869418.1
NBCI Gene record:
Gm8430 (667035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_869418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095035 GCATAAGAGGAAGAAGGTTAA pLKO.1 378 3UTR 100% 10.800 5.400 Y Rps27a n/a
2 TRCN0000095038 GAGAGTGTCCTTCTGATGAAT pLKO.1 458 3UTR 100% 5.625 2.813 Y Rps27a n/a
3 TRCN0000095034 CCGGACTTTGTCTGACTACAA pLKO.1 261 3UTR 100% 4.950 2.475 Y Rps27a n/a
4 TRCN0000095037 GAGGCTGATCTTTGCTGGTAA pLKO.1 225 3UTR 100% 4.950 2.475 Y Rps27a n/a
5 TRCN0000007187 GCCAAGATCCAGGATAAGGAA pLKO.1 184 3UTR 100% 3.000 1.500 Y RPS27A n/a
6 TRCN0000273406 GCCAAGATCCAGGATAAGGAA pLKO_005 184 3UTR 100% 3.000 1.500 Y RPS27A n/a
7 TRCN0000095036 CTGAAATACTATAAGGTGGAT pLKO.1 409 3UTR 100% 2.640 1.320 Y Rps27a n/a
8 TRCN0000007190 GAAGTCTTACACCACTCCCAA pLKO.1 348 3UTR 100% 2.640 1.320 Y RPS27A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_869418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01463 pDONR223 100% 69.6% None (many diffs) n/a
2 ccsbBroad304_01463 pLX_304 0% 69.6% V5 (many diffs) n/a
3 TRCN0000467660 GACATATACGATGGCGTATCTATA pLX_317 64.1% 69.6% V5 (many diffs) n/a
Download CSV