Transcript: Mouse XR_873137.1

PREDICTED: Mus musculus UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2 (B3galnt2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
B3galnt2 (97884)
Length:
1377
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_873137.1
NBCI Gene record:
B3galnt2 (97884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_873137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179380 GCTCGAAATAACCACGAACTT pLKO.1 512 3UTR 100% 4.950 6.930 N B3galnt2 n/a
2 TRCN0000195925 CTTACCGGAATGTTCCTGCAA pLKO.1 1279 3UTR 100% 2.640 3.696 N B3galnt2 n/a
3 TRCN0000217312 GTGAACAAGCTCTGGTATAAG pLKO.1 941 3UTR 100% 13.200 9.240 N B3galnt2 n/a
4 TRCN0000251169 GTGAACAAGCTCTGGTATAAG pLKO_005 941 3UTR 100% 13.200 9.240 N B3galnt2 n/a
5 TRCN0000251171 TTGCTGCATCATCCTACATTA pLKO_005 566 3UTR 100% 13.200 9.240 N B3galnt2 n/a
6 TRCN0000271579 GAGAGCTTTGAAGGTACAATC pLKO_005 986 3UTR 100% 10.800 7.560 N B3GALNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_873137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05019 pDONR223 100% 49.1% None (many diffs) n/a
2 ccsbBroad304_05019 pLX_304 0% 49.1% V5 (many diffs) n/a
Download CSV