Transcript: Mouse XR_881067.2

PREDICTED: Mus musculus expressed sequence AI464131 (AI464131), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
AI464131 (329828)
Length:
2762
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_881067.2
NBCI Gene record:
AI464131 (329828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_881067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252435 ATCCGCCAGCACCGCTTTAAT pLKO_005 1221 3UTR 100% 15.000 21.000 N AI464131 n/a
2 TRCN0000252434 TCCGTTCATCTTGCCCGATAT pLKO_005 1841 3UTR 100% 10.800 15.120 N AI464131 n/a
3 TRCN0000258238 CATCCGTTTGTCAACTATAAC pLKO_005 1377 3UTR 100% 13.200 10.560 N AI464131 n/a
4 TRCN0000252432 TTGTCACGAGCGACGTCTATT pLKO_005 829 3UTR 100% 13.200 9.240 N AI464131 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_881067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08729 pDONR223 100% 65.3% None (many diffs) n/a
2 ccsbBroad304_08729 pLX_304 0% 65.3% V5 (many diffs) n/a
3 TRCN0000481462 CAGCTTTTCTACTGCCAAGTCACG pLX_317 24.6% 65.3% V5 (many diffs) n/a
Download CSV