Transcript: Human XR_921909.3

PREDICTED: Homo sapiens axin interactor, dorsalization associated (AIDA), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AIDA (64853)
Length:
3265
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_921909.3
NBCI Gene record:
AIDA (64853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_921909.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262344 ATCTGAATGGCATAGACTTAA pLKO_005 1194 3UTR 100% 13.200 18.480 N AIDA n/a
2 TRCN0000262336 GCCAATTGTAATAGAACTATA pLKO_005 1417 3UTR 100% 13.200 18.480 N AIDA n/a
3 TRCN0000262340 GCTAGAGTTCCCGGTACTTTA pLKO_005 1058 3UTR 100% 13.200 18.480 N AIDA n/a
4 TRCN0000262339 TCGGAACCAGGAATGACATTA pLKO_005 1094 3UTR 100% 13.200 18.480 N AIDA n/a
5 TRCN0000262338 GAAGCTAGAACCAATCCTAAA pLKO_005 854 3UTR 100% 10.800 15.120 N AIDA n/a
6 TRCN0000262342 GTACACATGAGGTGGATATTT pLKO_005 2620 3UTR 100% 15.000 12.000 N AIDA n/a
7 TRCN0000262343 ACAGTCTCAAGAAGAATTTAA pLKO_005 818 3UTR 100% 15.000 10.500 N AIDA n/a
8 TRCN0000262341 GCCCAAGCTCAACACAATAAT pLKO_005 714 3UTR 100% 15.000 10.500 N AIDA n/a
9 TRCN0000282201 ATGTTCAGCCTGTCCCATTAA pLKO_005 910 3UTR 100% 13.200 9.240 N AIDA n/a
10 TRCN0000122144 GCAGGTCATTAGCTTACTATA pLKO.1 2558 3UTR 100% 13.200 9.240 N AIDA n/a
11 TRCN0000143743 GAATTGCGAAGTGCAGCTTTA pLKO.1 789 3UTR 100% 10.800 7.560 N AIDA n/a
12 TRCN0000262337 GTGTAATCACCCTAGTCATAC pLKO_005 2771 3UTR 100% 10.800 7.560 N AIDA n/a
13 TRCN0000144238 CAGGAATGACATTACTCACTA pLKO.1 1101 3UTR 100% 4.950 3.465 N AIDA n/a
14 TRCN0000122254 CCCTATATTACAGTTAGTGTA pLKO.1 1169 3UTR 100% 4.950 3.465 N AIDA n/a
15 TRCN0000143016 GCGATAGACGAGTATCAGATA pLKO.1 669 3UTR 100% 4.950 3.465 N AIDA n/a
16 TRCN0000144615 GCTGTTCTTCTACATCACATT pLKO.1 2224 3UTR 100% 4.950 3.465 N AIDA n/a
17 TRCN0000140914 CCTGACATGATGAACCTGGAA pLKO.1 1533 3UTR 100% 2.640 1.848 N AIDA n/a
18 TRCN0000139505 CCTGCTTAGAAAGTGTGCCTT pLKO.1 2093 3UTR 100% 2.640 1.848 N AIDA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_921909.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03979 pDONR223 100% 28.1% None 1_578del;930_961del;1529_3265del n/a
2 ccsbBroad304_03979 pLX_304 0% 28.1% V5 1_578del;930_961del;1529_3265del n/a
3 TRCN0000473685 CTTAATCATGCAGCTAGGAGGGGT pLX_317 43.1% 28.1% V5 1_578del;930_961del;1529_3265del n/a
Download CSV