Transcript: Human XR_923051.2

PREDICTED: Homo sapiens Kruppel like factor 7 (KLF7), transcript variant X12, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLF7 (8609)
Length:
1809
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_923051.2
NBCI Gene record:
KLF7 (8609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_923051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084230 CTCAACGCAGTGACCTCATTA pLKO.1 794 3UTR 100% 13.200 18.480 N Klf7 n/a
2 TRCN0000013261 GTGCCGGAAAGTTTATACAAA pLKO.1 1081 3UTR 100% 5.625 7.875 N KLF7 n/a
3 TRCN0000013262 CTTGAATTGGAACGCTACCTA pLKO.1 515 3UTR 100% 3.000 2.400 N KLF7 n/a
4 TRCN0000257275 ACGGGTGCCGGAAAGTTTATA pLKO_005 1077 3UTR 100% 15.000 10.500 N KLF7 n/a
5 TRCN0000232328 TAACGGGTGCCGGAAAGTTTA pLKO_005 1075 3UTR 100% 13.200 9.240 N Klf7 n/a
6 TRCN0000232325 TCAACGCAGTGACCTCATTAA pLKO_005 795 3UTR 100% 13.200 9.240 N Klf7 n/a
7 TRCN0000235752 TCAACGCAGTGACCTCATTAA pLKO_005 795 3UTR 100% 13.200 9.240 N KLF7 n/a
8 TRCN0000235751 ATGGCACGGTGACGTTGAAAC pLKO_005 882 3UTR 100% 10.800 7.560 N KLF7 n/a
9 TRCN0000013260 GCTACTTCTCAGCTTTACCAT pLKO.1 465 3UTR 100% 3.000 2.100 N KLF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_923051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11283 pDONR223 100% 36% None (many diffs) n/a
2 ccsbBroad304_11283 pLX_304 0% 36% V5 (many diffs) n/a
3 TRCN0000469755 CCACTTGTTCCCCGACCCCATAAG pLX_317 52.5% 36% V5 (many diffs) n/a
Download CSV