Transcript: Human XR_924191.3

PREDICTED: Homo sapiens ATPase 13A4 (ATP13A4), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP13A4 (84239)
Length:
4316
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_924191.3
NBCI Gene record:
ATP13A4 (84239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_924191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165824 GCAGCCTACTGCCAAAGATAT pLKO.1 2493 3UTR 100% 13.200 18.480 N ATP13A4 n/a
2 TRCN0000165065 GCCGGATCCATCTTCTCATTT pLKO.1 179 3UTR 100% 13.200 18.480 N ATP13A4 n/a
3 TRCN0000160049 CCTCATCAGCATCTATATCTT pLKO.1 2322 3UTR 100% 5.625 7.875 N ATP13A4 n/a
4 TRCN0000161248 GAGGTTAATATGTGGGCCTAA pLKO.1 604 3UTR 100% 4.050 5.670 N ATP13A4 n/a
5 TRCN0000159375 GTATATGATCTCAGAGAGCAA pLKO.1 791 3UTR 100% 2.640 3.696 N ATP13A4 n/a
6 TRCN0000165242 GCCCTTGACGTCATCACAATT pLKO.1 1370 3UTR 100% 13.200 10.560 N ATP13A4 n/a
7 TRCN0000220058 CTTGGCTTCTGAAGGTATTAG pLKO.1 3927 3UTR 100% 13.200 9.240 N ATP13A4 n/a
8 TRCN0000161566 GCTCATCAAGGAGGTTCTAAA pLKO.1 661 3UTR 100% 13.200 9.240 N ATP13A4 n/a
9 TRCN0000220059 GTATACTCACGGAGTTGTAAT pLKO.1 4095 3UTR 100% 13.200 9.240 N ATP13A4 n/a
10 TRCN0000166421 CTCTACCCTAAGCCAGTGAAT pLKO.1 1223 3UTR 100% 4.950 2.970 N ATP13A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_924191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14308 pDONR223 100% 58.3% None (many diffs) n/a
2 ccsbBroad304_14308 pLX_304 0% 58.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477341 GCCTGCTTTTAAACAATCATGTAG pLX_317 13.4% 58.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV